نمونه سئوالات  درس  زیست شناسی وآزمایشگاه   پیش دانشگاهی          رشته علوم تجربی           مربوط به صفحات 12تا20

1- در جاهای خالی کلمات مناسب بنویسید .                                                                      

الف- اگرکدون mRNA ای ، UAC باشد ؛ آنتی کدون مربوط به آن ............... است .

ب- در جریان ترجمه ، کدون  ................ هیچ گاه در جایگاه P ریبوزوم قرار نمی گیرد .

پ - اگر رمز موجود بر روی DNA ، ACG باشد ، رمز tRNA مربوط به آن..........  می باشد .

ج- مناطقی از mRNA اولیه که ترجمه نمی شود و حذف خواهد شد ، ...........  نام دارد .

د- به انتهایACC از tRNA ها ............................   متصل می شود .

2- باتوجه به ملکول mRNA ی مقابل    ACCAUGAUGUCCAUGCCCUAA

                                                          ج               ب                       الف

در برابر موارد زیرعلامت ص  یا غ  بگذارید .                   

الف - کدون الف اولین کدونی است که آنتی کدونش به جایگاه Aوارد می شود. (         )

ب-tRNA ی مربوط به کدون (ج) فقط می تواند به جایگاه A وارد شود. (           )

ج- کدون (ب) می تواند در هردوجایگاه AوPبه ترتیب  وارد شود. (           )

د- کدون (ج) فقط می تواند به جایگاه Pوارد شود.  (              )

3- پاسخ کوتاه دهید:       

الف- tRNA آغازگر چیست؟              

ب- آنتی کدون tRNA آغازگر کدام است؟

پ- در مرحله آغاز ترجمه ، tRNAآغازگر وارد کدام جایگاه شده ؟

ج- اولین کدونی که در جایگاه P قرار می گیرد چیست ؟

چ- چنانچه رمزDNA ،TATباشد،آنتی کدون مربوط به آن کدام است؟

4- mRNAمقابل را در نظر گرفته و به سوالات زیر پاسخ دهید:              UCAAUGGCCACGUAGCGA

الف- اولین کدونی که در جایگاهA قرار می گیرد چیست؟

ب- سومین آنتی کدونی که در جایگاهP قرار میگیرد چیست؟

ج- آخرین کدونی که در جایگاه P قرار می گیرد  چیست؟

د- هنگام ترجمه،چند آمینو اسید در رشته پلی پپتیدی قرار می گیرد؟

5 - اصطلاحات زیررا تعریف کنید .


الف- اگزون :     

 

ب- ژن های گسسته :

ج- کدون :

6- مراحل مختلف پروتئین سازی که در زیرآمده است را به ترتیب، از شروع به پایان ترجمه، مرتب نمایید.

الف- tRNA با دو آمینو اسید در جایگاه A قرار دارد. و Pخالی است.           

ب- ریبوزوم بر روی  mRNA حرکت میکند.                                          

ج- آنتی کدون با کدون   AUGدر جایگاه P جفت می شود.

د- کدون UGA، در جایگاه Aقرار میگیرد.

ح-  جایگاه A  و P  بوسیله   tRNA  اشغال شده است.

7- یک mRNA اولیه ی یوکاریوتی شامل 3رونوشت اگزون است جهت ایجاد mRNAبالغ :

الف- چند پیوند فسفودی استر هیدرولیز می شود ؟

ب-  چند پیوند فسفودی استر ایجاد می شود ؟

 

8- چگونه عمل ترجمه پایان می یابد؟

 

 

9- رمز DNAچگونه شناخته شد؟

 

10- شکل زیر بخشی از مرحله آغاز پروتئین سازی رانشان می دهد ،نام اجزای شماره گذاری شده را بنویسید.

 

 

 

 

 

 

 

« موفق باشید»